Sign up now for a
Free Email Account &
your own Online
Writing Portfolio!
Username:
Password:  
Blog Calendar
<<     February     >>
SMTWTFS
   1234
567891011
12131415161718
19202122232425
26272829
Complete archive | RSS

More Blogs

Sponsored Items

Click Here To Bid  

Read a Newbie
Badges
Seasons Summer
Presented To:
ShelleyA

Testimonials
Tell a Friend
Know someone who'd
like this page?

Email Address:

Optional Comment:

Who's Online?
Members: 366    
Guests: 638    

   
Total Online Now: 1004    
Writing.Com Time

Wednesday
February 15, 2012
10:24am EST


Content Rating Notice:  Recommended for Readers 18 Years and Older Only
  >> Book >> Comedy >> ID #1044927  |   Show DetailsPrinter Friendly Page Tell A Friend
blog, Blog, BLOG!!!!!!
Humor, in blog format (you know you wanna rate this...)
Rated:
18+
by
Avg Rating: (8)
 
Welcome to my humble abode.

If you haven't yet caught on, this is, in fact, a blog which serves to house the thoughts that will not fit in the cubicle that is my head.

So kick off your shoes and make yourself at home!

A PLEDGE
I, <insert my name here> (he, he, he. You thought I was really going to tell you, didn't you? Not that it isn't pretty obvious, but...) PROMISE never, ever, ever, ever, ever to take life seriously. I PROMISE never to bore my readers with the useless garbage of my every day life, or with sappy emotional crap that no one cares about.

One last thing. The first entry of this blog "Just who the hell am I? is something of an identity revealing...uh...thing, i guess. So, um, read it!

NOTE: the entries in this blog are, at times, completely random and senseless. Welcome to my brain.
There are 22 visible Entries. Viewing page 1 of 2 with 20 per page.
Sort:     To Page:     Search:


22.  DisclaimerID #395817 
Posted: 12-31-2005 @ 4:26 pm EST 
Edited: 1-10-2006 @ 10:50 am EST 

Hello friend,
If you're reading this, you've successfully stumbled onto my little corner of the world. (duh) Once again, I'd like to welcome you to my brain.

If you've been here before, you're probably wondering just what, exactly, my parents dropped me onto as a child that could have caused the chaos that you see before you now. Unfortunately, I, myself, am unsure about that particular detail of my past.

My writing, as it appears on this blog, is, as you've probably noticed, strange, absurd, and occasionally downright offensive. Many of these entries make little or no sense whatsoever. Why?

It's simple. I write on whims. I take a single sentence (i.e. "Get yo' cabbage patch on" which I honestly did hear on the radio one day) and I turn it into an incredibly short story, or a top ten list, or a how-to manual, or anything else that comes to mind.
Because this is a journal, of sorts, I switch off the censor inside my head that usually governs my writing, and I let the words flow.

That's basically it. I hope you enjoy this disaster of mine, and, should I offend you to the point of outrage, I look forward to settling outside of court.

Happy Reading!

 


21.  World PeaceID #404803 
Posted: 2-5-2006 @ 3:52 pm EST 

I am an advocate of peace. I would like nothing more than to be able to walk the streets at night, screaming obscenities and exposing myself to random pedestrians, without having to worry about being attacked, robbed, and left for dead by a gang of senseless criminals.

But let's face it, folks. That just isn't going to happen. No matter how hard we try, it is virtually impossible to weed all of the psychopathic weirdos out of our beautiful society.

But do not give up yet, my faithful friends, for I have a solution! My plan is this:

Virginia.

Don't get me wrong, I have nothing against Virginia. I simply picked a state at random, and went from there. Anyhow, here's the plan for Virginia.

We mark off a square parcel of land in the state. 100 square miles should be enough to start out with, and we can always increase it later.

Once we've got our land sectioned, we begin the tedious process of ratifying a 51st state. We'll call the state East Virginia, for obvious reasons.

And that's it. We stop there, neglecting to create a government of any kind in the state. There will be no laws in East Virginia. Nothing will be illegal.

Finally, we'll ship in the psychopaths. We'll let them rape, murder, and mutilate any idiots that happen to wander through the area. All we have to do is remember to stay the hell away from East Virginia.

Keeping the criminally insane in this small area will be a sinch. We'll just use the state as a dumping ground for the illegal substances confiscated by law enforcement officials in the other 50 states in the union. Every month or two, we'll ship in another load of reinforcement narcotics.

So there you have it. This is my plan that will undoubtedly succeed in removing dangerous criminals from the streets of our cities and villages. Before long, you and I will be able to litter, loiter, and vandalize once more without having to worry about being violated.






 


20.  More Fun With GeneticsID #403350 
Posted: 1-30-2006 @ 5:01 pm EST 
Edited: 1-30-2006 @ 5:02 pm EST 

As I read my Genetics textbook yesterday afternoon, I came across a phrase that has illuminated an important concept in my mind.

To say the very least, grasping this concept has forever altered the course of my life.

I'd like to share that phrase with you now, but first, I must give credit where credit is due. So here's the citation:

Pierce, Benjamin A. Genetics: A Conceptual Approach 2nd Edition; W.H. Freeman and Co., NY, NY 2005.

And now, the key piece of information guaranteed to unlock the puzzle of your life, as it appears in the text.

"The expression of the allele for pattern baldness is clearly enhanced by the presence of male sex hormones; males who are castrated at an early age rarely become bald (but castration is not a recommended method for preventing baldness)" (Pierce 116).

Thanks to this crucial bit of information, the cruel practice of castrating balding infants can finally come to a halt.

Benjamin Pierce, this Bud's for you.


 


19.  Musical ChairsID #402595 
Posted: 1-27-2006 @ 2:30 pm EST 
Edited: 1-28-2006 @ 10:51 pm EST 

I've got a confession to make. I'm probably the only waitress that has ever admitted to this, but I simply cannot hide it any longer. I might as well just come right out and say it.

I'm addicted to seating customers.

I absolutely love it when the diner gets crowded, and hoardes of hungry people line up near the counter, waiting for a booth to clear. And, when a vacant table finally becomes available, I can hardly hide my excitement as I rush to greet the next waiting party.

"Through the power invested in me by the chain-smoking bastard that runs this place," I usually say, "I now present you with..."

*suspenseful pause*

"...a BOOTH! Yes, that's right. Your time has come. The gates of fine dining have opened, and I have chosen you, and only you, to accompany me through this portal. Fear not, for you shall stand no more! Please, by all means, sit down, and enjoy the piss-poor lumbar support offered to you by these, our sparsely padded seats."

Mmmmmm... seating people.
I tell you, it's like playing God...














 


18.  Top Ten, AgainID #402047 
Posted: 1-25-2006 @ 2:58 pm EST 
Edited: 1-29-2006 @ 4:02 pm EST 

Top Ten Things You Never Want To Hear On A Blind Date

10. "How do I want my steak cooked? I don't. In fact, if there's any way I can get it while it's still twitching..."

9. "Hold on a sec. That's my cell. I better take this call. Hello? Oh, hi Steve. Did you finish digging that hole? Good. Go ahead and start planting the explosives..."

8. "Yeah, the colostomy bag gets pretty annoying. But look at it this way. My, uh, "soldier" can still "salute" with the best of 'em, if you know what I mean..."

7. "So say that you were to be... oh, I don't know... accidentally beaten over the head with a tire iron and left for dead outside of this very restaurant. How much would your love ones rake in in life insurance benefits? 20 grand? 25? Of course, we're just speculating here, but..."

6. "Well, what most people don't know about the counterfeiting process is that..."

5. "What the hell are you doing? I said get into the backseat of the car! The cat ALWAYS rides shotgun! What are you, some sort of whack job? Geez..."

4. "Of course, that's just my day job. In my spare time, I like to fashion christmas tree ornaments out of freeze-dried roadkill."

3. "Ordinarily, yes, it would be murder. But, as I'm sure you recall from your history textbooks, when God tells you to off a group of ne'er-do-wells, it's called a crusade..."

2. "Don't worry, I brought an extra tinfoil helmet. Now remember, at exactly 4:17, we put on the hats, get under the table, and wait until the satellite has passed completely over this portion of the northern hemisphere..."

1. "But you've had a tetanus booster, right? What about the small pox vaccine? Good. Now, if you could just sign the waiver here... here... and here. Great! Oh, and if you could go ahead and write your blood type right beside your signature... you know, for legal reasons..."






 


17.  Did You Know?ID #401913 
Posted: 1-24-2006 @ 10:23 pm EST 
Edited: 1-27-2006 @ 4:52 pm EST 

DID YOU KNOW?

An anthology of every-day wisdom, for references purposes only.

DID YOU KNOW... that dry cleaning is not the same as vacuuming?

DID YOU KNOW... that a de-clawed cat can still bite the hell out of your arm if it wants to?


DID YOU KNOW... that most bowls are microwaveable, but most spoons are not?

DID YOU KNOW... that 'hostile' and 'hostel' are NOT interchangeable?

DID YOU KNOW... that if you try to be a smartass by checking "other" under the box marked GENDER on a survey, no one will laugh, and friends will begin eyeing you suspiciously?

DID YOU KNOW... that the "Don't Feed Me, I Bite" signs on cages in the zoo are NOT there solely for novelty purposes...?

DID YOU KNOW... that no matter how loud you think a party is, everyone will always stop talking at the exact moment that you decide to make a passing reference to genitalia, be it yours or otherwise..?

DID YOU KNOW... that there really ISN'T a tooth fairy?

DID YOU KNOW... that despite those embarrassing moments of revelation, it is still better to allow the world to see the crack of your ass every time you bend over than it is to invest in suspenders?

DID YOU KNOW... that, a few years or so ago, the word 'gay' ceased to be synonymous with the word 'happy'?

DID YOU KNOW... that a "donut" is one of a number of tricks that will not work on a bicycle?

DID YOU KNOW... that despite what it looks like in the painting, dogs are not physically capable of holding a poker hand between their paws, let alone comprehend the statistics of card counting...?

DID YOU KNOW... that most mathematicians prefer to use the term "circular pyramid" when referencing anything conical?

DID YOU KNOW... that the best way to prevent excess pet fur from accumulating on the furniture is to lint-roll the cat?





 


16.  Another Top TenID #398693 
Posted: 1-11-2006 @ 7:30 pm EST 
Edited: 1-19-2006 @ 1:38 pm EST 

Top Ten Signs It's Time to Find a New Doctor

10. He offers you treatment, but then makes you wait "until the lawyer gets back from lunch."

9. He cannot say the word "prostate" without giggling hysterically.

8. To save you money, he offers to replace traditional anesthesia with a quick blow to the base of the skull.

7. He performs operations with a "safety" scalpel.

6. He phrases all of his explanations in the form of a question, and insists on calling you "Alex"

5. He reads you your diagnosis, word-for-word, from the Encyclopedia Brittanica

4. He drinks coffee from a urine collection cup.

3. Instead of measuring your vital signs, he prefers to take them via "guestimation"

2. The nurses secretly call him "Leatherface" behind his back

1. He writes legible prescriptions.
 


15.  Everybody's a ComedianID #401372 
Posted: 1-22-2006 @ 4:37 pm EST 
Edited: 1-22-2006 @ 5:21 pm EST 

I work at a pizza place. Not a restaurant, mind you, or a diner. Just a place.

After waitressing for a few short months, I couldn't help but notice that sometimes, people don't think about what they're saying. And most of the time, these "mishaps" are pretty funny.

So, I've decided to dedicate one entry (or more, if this gets to be too long) entirely to those slips of the tongue that come from the everyday comedians of the world.

So here goes. Enjoy!

You Asked Me WHAT!?
___________________________________________________________________________

"Is the small the smallest pizza you guys have, or is there something smaller?"
___________________________________________________________________________

"I'd like the Pepperoni Lover's pizza, but could you hold the pepperoni?"
___________________________________________________________________________

"I'll take the Vegetarian sandwich on sourdough, but can you add smoked turkey to that?"
___________________________________________________________________________
SOME DUDE ON PHONE: "How big are your medium pizzas?"

ME: "12 inches."

SOME DUDE ON PHONE: "Yeah, that sounds about right... Wait- how many slices is that?"

___________________________________________________________________________

"I'd like to order a small, one-topping pizza with two toppings..."
___________________________________________________________________________

SOME DUDE ON PHONE: "Can I get a pizza delivered?"

ME: "Sure. What's the address?"

SOME DUDE ON PHONE: "##### W. Buchanan, apartment 5."

ME: "Okay, we'll have the pizza there in a half an hour."

SOME DUDE ON PHONE: "You mean I gotta go home to pick it up?"

ME: "I beg your pardon?"

SOME DUDE ON PHONE: "Well I'm at the bar right now."

___________________________________________________________________________

PERSON ON PHONE: "I'd like to place an order for Carry-Out."

ME: "Okay, sir, what can I get for you?"

PERSON ON PHONE: "I'm a ma'am."

___________________________________________________________________________

WOMAN IN BOOTH: "What's your bleu cheese dressing look like?"

ME: "I don't know. It comes in a packet."

WOMAN IN BOOTH. "Oh. What's the packet look like?"

___________________________________________________________________________

PERSON IN BOOTH: "Oh, and I'd like a small salad before the meal."

ME: "Okay. What kind of dressing do you want?"

PERSON IN BOOTH: "It comes with dressing?"







 


14.  Vegetarian muffinsID #400914 
Posted: 1-20-2006 @ 5:14 pm EST 
Edited: 1-20-2006 @ 5:37 pm EST 

When my alarm clock began its usual screeching uluation at 7:00 this morning, I smacked it as hard as I could with my fist, and, muttering a random string of consonants under my breath, groggily rolled out from under the covers and awoke to greet the day.

I shuffled around my dark dorm room, finally making my way through the bathroom door, and flipping the switch to turn on the lights. After staring at my wardrobe for a few minutes, I realized that I'd stumbled into the closet by mistake.

Shuffling around a bit more, I made it into the bathroom, where I showered and brushed my teeth. After a quick stop back in the closet, I changed clothes and left.

I got a few feet down the hall before I remembered that I'd forgotten to pee. So I went back and took care of that, and then left for the cafeteria.

Picking up a tray and a fork, I headed for the breakfast line. Halfway there, I dropped the fork, and had to turn back and get another one. Finally, I reached the food area. I requested my usual (2 pancakes and one helping of scrambled eggs), and helped myself to a glass of orange juice.

Up until that moment, my morning had gone exactly as scheduled. My daily routine was unfolding nicely before me.

And then I reached the muffins.

I'm a muffin person. If they have muffins, I'll get one. Well, they had muffins all right. Blueberry muffins. And in front of the tray on which they sat, there was a sign, which read:

VEGETARIAN MUFFINS

What the hell was in these muffins to begin with? Because there really isn't a whole lot that you can sneak into a muffin without causing a noticable irregularity in the texture of the thing. What did they do, run out of Canola oil at the last minute and decide to use bacon grease instead? Because even that would have been noticeable, tastewise, I mean.

I must say, however, that the vegetarian muffins were quite good. I ate seven of them.

But for some reason, I just didn't have an appetite for my eggs, pancakes, or orange juice.





 


13.  Band-aids, Anyone?ID #398276 
Posted: 1-10-2006 @ 10:58 am EST 
Edited: 1-15-2006 @ 3:26 pm EST 

I cut myself shaving this morning. Slipping and sliding on wet linoleum, I made my way to the medicine cabinet to grab a bandaid.

For some reason, my attention was drawn to the printing on the box.

Below the BAND-AID logo, printed in small letters, was the word "sterile."

Is this really necessary? Do we need to be reassured that these blood-stopping, self-sticking gauze pads are, in fact, sterile? Because personally, I just assumed that that was a given characteristic of the product. What's the point of covering a wound if you're going to seal it with a germ-infested barrier?

Do you think you can buy unsterile BAND-AIDS? Would anyone, looking at both varieties, actually nod and say to themselves,

"Unsterile bandages. Hmmm. These'll be perfect for the kids."

Then again, there are those among men who would buy such an item. These are the same people that get their underwear from the Salvation Army.


 


12.  PotatoesID #400380 
Posted: 1-18-2006 @ 8:58 pm EST 

I happened to come across an interesting fact as I was flipping through my Genetics book and scrawling down incorrect answers in an attempt to finish the assignment on time.

Did you know that potatoes have 48 chromosomes? That's right. Forty-eight.
(oh, and in case your memory needs refreshing, humans have a grand total of...drumroll please!... 46 chromosomes.)

As I read these words, I felt anger boiling in the pit of my stomach. I've been trumped by a fucking potato, I thought to myself. And I don't even like potatoes. French fries, yes, but not potatoes themselves

But never fear, my fellow Homo sapiens, for I've already devised a simple plan to solve this dilemma.

I'm going to introduce 4 new chromosomes into the human genome. Because, if you think about it, the coding possibilities are pretty much endless. Why, with just a few short sequences of AGTTCCAATCTTACGGGTTACATCATTGGCAAAATGGCATTCAA, or maybe GGTTTTTTTTTTGGGGGGAACCGTACGTAAACCCCC, I could make a human with an extra pair of arms, or a third leg, or toenails that trim themselves, or stainless-steel teeth, or glow-in-the-dark skin, or transparent eyelids, or feathers, or,...or...

Well, you get the idea.




 


11.  Desert IslandsID #394750 
Posted: 12-26-2005 @ 11:35 am EST 
Edited: 1-1-2006 @ 7:03 pm EST 

Just the other day, a friend of mine (who I'll call Johann Sebastian Bach, XII) asked this of me:

If you knew that tomorrow you would suddenly and unexpectedly find yourself trapped on an unmapped desert island in the middle of the Pacific ocean, what three things would you gather up today to take with you on your upcoming excursion?

"Hmph," I said to Johann Sebastian Bach, XII, "That's simple. I'd pack a Cessna, a pilot, and a flight attendant."

"????," asked Johann Sebastion Bach, XII. (I forgot to mention that Johann is deaf, and communicates to me through a mixture of sign language, charades, and innapropriate gestures)

"Well," I replied, "I'd use the plane and the pilot to get the hell off of the island."

"???!!?!!?" he asked.

"Oh, the flight attendant? I don't really need one. But you said I could pack three things, and I figured I'd become a little famished on the long trip across the Pacific, so I decided that it might be handy to have someone nearby to serve me peanuts and club soda," I replied.

"No, no, no!" said Johann Sebastian Bach, XII. "You can't just leave!"

"Why not?" I asked him.

"Because it's a theoretical island. You can't fly off of something that doesn't exist. <gesture> Besides, I happen to know for a fact that you can't fit a plane and a pilot in the same suitcase. Now, if it was a wingless plane and a legless pilot, you might be able to get the zipper halfway closed, but that would be like robbing Peter to pay Paul, now wouldn't it? <gesture>"

Johann was right.

But, intrigued as I was, I couldn't just let a perfectly good question go unanswered.

I decided that if I couldn't leave the island, I could at least pack a few things to make my stay a little more pleasant. With this in mind, I came up with the following list of possibilities:

1. The Complete Works of William Shakespeare to use as kindling

2. Toilet Paper for obvious reasons

3. Green Day (and all of their musical accessories) to pick me up when I'm feeling blue

4. A dune buggy becuase dune buggies kick ass, I think. I've never actually seen one, but they certainly sound attractive...

5. A Do Not Disturb Sign to keep the damn buzzards out of my dune buggy

6. Johnny Depp for my own personal amusement

7. A Welcome mat for the bitchin' lean-to I plan to build using nothing but palm leaves and drift wood

8. The Chia Vegetable Garden for obvious reasons

9. a shirt that says "I'm With Stupid" to confuse the head-hunting natives into thinking that I haven't come alone, thereby reducing the chance that they'll select me as their next target

10. An alarm sundial because I tend to oversleep


 


10.  Cake?ID #398051 
Posted: 1-9-2006 @ 2:20 pm EST 
Edited: 1-10-2006 @ 10:49 am EST 

Have you ever noticed that there are some phrases in the English language that don't make a lick of sense?

Yesterday, I attempted to leap from the water tower in my home town using a plastic Wal-mart bag as a parachute. Why was I doing this, you ask? Because one of my best friends told me it would be a "piece of cake."

That's right. It would be as easy as a slice of the fluffy, moist, heavenly dessert that everyone knows of and most people (even old folks whose teeth are among our dearly departed) love.

But I was confused. Perhaps I'm just thick-headed, but I find it rather hard to gauge the difficulty of an activity using cake as a reference point. Are we talking about cake itself, or is the phrase a reference to the actual baking process? I suppose that if the latter is true, this would make some sense, but this would no doubt result in one simple question.

What kind of cake is it?

This is an important consideration. Anyone with arms and an oven can make one of those Betty Crocker cake-from-a-box numbers. That is easy. Trying to draw a scale portrait of the Sistene Chapel onto a wedding cake in frosting, however, isn't.

I suppose that if we established an Official Gauge Cake, then this whole mess of confusion would finally reach some sort of enlightened state, and the problem would be solved. Screw world peace, it's time America found a solution to the Cake Problem.

As I sit here, in my hospital bed, wrapped, from the tips of my toes clear to my left eyebrow, in a plexi-glass cast, I've come to a realization. If I could have asked my wise friend a simple question, I never would have climbed to the top of that water tower. That question is this.

On a scale of one to ten, with one being so easy Dubya could do it, and ten being cake, how difficult would you say this jump would be for me to make?

So please, call your congress(wo)man, and tell them to vote yes on Bill #459606782-034845685-2349856249-2340984509852-EKFOPV-02349850-23049457 (standard cake bill)

Thank you







 


9.  Top 10 Best SellersID #393562 
Posted: 12-19-2005 @ 11:37 am EST 
Edited: 1-1-2006 @ 6:58 pm EST 

I am so going to hell for this one...

Top Fifteen Best Sellers at the Vatican Gift Shop

15. Power Pontiff! posable action figure (hat, staff, and robe sold separately)

14. Mary's Immaculate Confections chocolate truffles

13. Lottery tickets

12. pewter scale-model Popemobile replicas

11. Altar boy Christmas tree toppers

10. In The Name of the Father, Son, and Tropical Spirit margarita mix

9. Benedict's Insta-Sermons Volume IV: Fire and Brimstone Edition Random House Publishing, NY, NY; 2005.

8. Bingo chips

7. Thou Shalt Not Sneeze! holy-water infused facial tissue

6. Nun-chucks

5. Bling-bling rosaries

4. Pina Colada-flavored communion wafers

3. Michael Jackson Live! The 6-DVD boxed set

2. Chia Pope

1. The 2006 Chippendale Calendar

What did you get for Christmas this year?
 


8.  Censor this!ID #393994 
Posted: 12-21-2005 @ 1:05 pm EST 
Edited: 1-11-2006 @ 7:23 pm EST 

This entry has inspired and I/O!

ID: 1056761
Invalid Item 
This item number is not valid.
by Not Available.



After making a few humble additions to the In & Out entitled "Writing.Com - Ology," I was shocked to find that my entries had been erased.

Confused, I sat crosslegged reflecting my suggestions. Three hours and one bitch of a charlie horse later, I had yet to come up with a single reason as to why someone would edit my honest thoughts from this wonderful website.

So, in order to settle some of the confusion, I have decided to post my entries here, in my own personal corner of the world, so that you, my loyal readers, can help to solve the mystery.

Ologies (and etc.) That Make Sense

1. mulletology: The study of 80's hairstyles

2. peek-a-gluteaology: The study of thongs in unnatural environments

3. Octagenariclogitology: The study of traffic patterns as they are influenced by blind elderly drivers

4. Predictafuckitology: The study of the systematic innacuracy of weather forecasts

5. Dubyaphobia: The fear of mispronouncing one's middle initial in front of a live studio audience.

6. Intellicreabullshitolution: The evolutionary theory proposed by the state of Kansas.

What, exactly, is the matter with these, my insightful additions? Do you know?

Please, enlighten me.
 

7.  Car TroublesID #399597 
Posted: 1-15-2006 @ 3:43 pm EST 
Edited: 1-19-2006 @ 8:42 pm EST 

I'm not what you'd call a car person. I have a basic idea of how my little white piece of crap works, and I'm able to perform minor maintenance procedures in order to keep it running in its usual piss-poor manner.

I avoid mechanics at all costs. I hate them. Oh, sure, they have an arsenal of tools which they've been trained to use, and can silence every squeak, pop, thunk, screech, squeal, and whir known to man. I'm not doubting their healing powers.

The problem with mechanics is that, each time I visit one, I have to perform an Emmy-worthy onomatapoeic impression of my car's latest illness, after which the mechanic, who knows perfectly well what I'm talking about, will ask me to repeat the description for his own personal amusement.

So, despite having a leaky air-conditioner, a broken dimmer switch, and a mysterious thumping noise that seems to originate from the general direction of the trunk, if asked, I will still tell you that my car is running fine.

And it is!

Because when I press on the gas, it goes forward.

And when I press on the brake... well... it usually stops.
 


6.  Chemistry, ShmemistryID #393079 
Posted: 12-16-2005 @ 4:00 pm EST 
Edited: 12-16-2005 @ 4:22 pm EST 

I'm tired, emaciated, and slightly senile, but I'm alive. For this semester, at least.

Sure, cell biology, literature, and Spanish were rough, but in the end, it was the Chemistry that finally did me in. Ugh. I'd rather let a woodpecker give me a lobotomy than take another course in that subject.

What, exactly, is the point of chemistry? Honestly.
Oh, sure, chemists can make drugs that cure horrible diseases like halitosis and male-pattern baldness. They can produce things like Teflon, Spandex, and distilled drinking water. And just where would America be if no one had taken the time to concoct that wonderful, grease-laden, butter substitute for movie popcorn? Why, we'd probably still be living in teepees, wielding sharpened sticks, and chasing buffalo around the plains like a bunch of idiots.

But what's wrong with that? The Indians seemed to do just fine without chemistry. Sure, they could have benefited from regular applications of sunscreen, but they had The Rain Dance. Anybody who can cause a temporary climate change just by shaking their tale feathers a bit is cool by my book.

(And last I checked, this is, in fact, my book.)

 


5.  A Stroke of Late-Night GeniusID #392414 
Posted: 12-13-2005 @ 10:04 pm EST 
Edited: 12-14-2005 @ 2:37 pm EST 

Lesser Known Bumper Stickers of the World.

"My Other Car is an Oldsmobile"

"NARROW LOAD"

"Don't Blame Me, I Voted Perot!"

"Proud Member of the Blind Motorist's Association"

"Honk If My Back Tire Falls Off Again"

"Been There, Mooned That"

"HWJG? (How Would Jesus Gesture?)"

"I Brake For Illegal Immigrants"

"Amish, and Damn Proud of It"

"Chernobyl, OR BUST!!!!!"

"My Kid Flunked Basic Algebra At Liberty Jr. High School!!!"

"REAL Men Wear Kilts"

"I'd Rather Be Driving The Weinermobile"

"If you can't see my mirrors, but you can read this sign, it's time to ask your optometrist if bifocals are right for you."

"POTHOLE!!! (Ha ha, made ya swerve)"

"Honk, I'm narcoleptic"











 


4.  The Restroom: An Instruction Manual for MenID #392353 
Posted: 12-13-2005 @ 4:40 pm EST 
Edited: 1-18-2006 @ 9:12 pm EST 

NOTE after receiving a few comments from men that this entry is "strange," I thought I'd comment a bit on the wreckage that follows.

It's pretty simple. I got tired of falling into the toilet. Hopefully, this manual will eliminate that problem (and others) from occuring.


How to piss in a woman's bathroom.
A step-by-step guide for men.

1. Turn to girlfriend/wife/lover/total stranger and
ask (politely!) to be excused for a moment.
FYI There is no need to announce your
intended destination. We can figure this
out on our own.


2. If you aren't already standing, do so now.

3. Walk to restroom.

4. Enter bathroom through doorway, being sure to close
door behind you.

5. Locate sanitary waste collecting apparatus. Take
note of its overall appearance at this time.

7. Flip on fan (optional, but strongly encouraged),
and proceed about your business.

8. Flush. Repeat, if necessary.

9. Check toilet paper roll. Is it empty? If so, remove
empty tube, and replace with a fresh roll.

10. Wash hands. THIS MEANS YOU

11. Return to waste collection apparatus. Inspect
visually. Wipe any stray drops from seat area.

12. Is seat still in upright position? If so, adjust
at this time.

13. Turn off fan (if applicable)

14. Exit restroom area in an orderly fashion.

TROUBLESHOOTING
Problem: I can't find the toilet
Solution: Make sure bathroom light is on. If it is,
and the toilet is still not visible, you're
probably not in the right room.

P: What is this toilet paper of which you speak?
S: Toilet paper, formally known as "bath tissue," is a
tool to aid you in your quest to achieve personal
cleanliness. The product comes in roll form, and
can usually be found within arm's length of the
waste collection apparatus. If this is not the
case, you may have to execute an emergency
procedure known as "changing the roll." For a
detailed description of this complicated manuever,
please refer to "Replenishing Bath Tissue for
Total Idiots." (available wherever books are sold)

P: Where the fuck's the Sport's Illustrated?
S: This is a woman's restroom. You'll have to do
without.
In fact, if you DO find back issues of Sport's
Illustrated
, Field and Stream, or
How To Turn A Broken Weedeater Into A Bitchin' Hot
Rod in 30 Days or Less
stacked next to the
john, you should be concerned. Very concerned.

P:Upon receiving these instructions, I promptly
wadded them up and tossed them in the trash.
I am hopelessly confused, but I firmly refuse to
either a)ask for help or b)fish the directions
out of the waste basket and read them, because
doing either of these things will cause
irreversible harm to my manly ego. I don't need
your advice. However, if I just "happened" to
overhear it, I might be able to spare a few
appreciative grunts, and then we could both go
our separate ways and pretend this never
happened.


S: My advice? Give up dating. I hear the Catholic Church is experiencing a shortage of priests lately...








 


3.  Cabbage Patch? (another random, senseless tale)ID #394965 
Posted: 12-27-2005 @ 2:33 pm EST 
Edited: 12-27-2005 @ 2:55 pm EST 

I was sitting in my multi-million dollar mansion the other day, sipping herbal tea and dantily daubing at my mouth with a paper napkin made from recycled one hundred dollar bills, when a voice on the radio caught my attention.

Get yo' cabbage patch on! the DJ said. Instantly, the sounds of Holiday spewed forth from the radio, as if in response to this informal demand.

Befuddled, I rose slowly from my mink sofa, reached beneath my Tiffany glass lamp shade and switched off the bulb, and stood with my mouth agape as the camera panned in for a close up.

Cabbage Patch? I thought to myself. Could it be true? Could I possibly have a cabbage patch somewhere in my possession?

Stroking my chin with thumb and forefinger, I tried to visualize the full extent of my domain, in hopes that I might come across my long lost garden of eden. No such luck.

With a snap of my fingers, I signalled for Manuel, my indentured servant, to bring my byplane around front. He did just that, and in a few short moments, we were airborne, soaring gracefully over the Midwestern country side.

But alas, no cabbage patch was to be found. Famished as I was from this unexpected escapade, I resigned to a warm bath in my clawfoot tub, sipping champagne out of a glass fashioned from the Hope diamond.

Tomorrow I thought to myself as Manuel added an extra spoonful of bath salts to the water, We'll have better luck tommorrow.





 



There are 22 visible Entries. Viewing page 1 of 2 with 20 per page.
Sort:     To Page:     Search:
Previous ... -1- 2 ... Next
© Copyright 2006 meg71186 (UN: meg71186 at Writing.Com). All rights reserved.
meg71186 has granted Writing.Com, its affiliates and its syndicates non-exclusive rights to display this work.

Log In To Leave Feedback
Username:
Password:
Not a Member?
Signup right now, for free!

All accounts include:
*Bullet* FREE Email @Writing.Com!
*Bullet* FREE Portfolio Services!